99
|
Thermo Fisher
dna primers for β2m Dna Primers For β2m, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna primers for β2m/product/Thermo Fisher Average 99 stars, based on 1 article reviews
dna primers for β2m - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
control gene β 2microglobulin Control Gene β 2microglobulin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control gene β 2microglobulin/product/Thermo Fisher Average 86 stars, based on 1 article reviews
control gene β 2microglobulin - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
β2m forward primer β2m Forward Primer, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/β2m forward primer/product/GenScript corporation Average 90 stars, based on 1 article reviews
β2m forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
β2m forward primer β2m Forward Primer, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/β2m forward primer/product/Biolegio bv Average 90 stars, based on 1 article reviews
β2m forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
akt2 forward primer Akt2 Forward Primer, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/akt2 forward primer/product/GenScript corporation Average 90 stars, based on 1 article reviews
akt2 forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
il-1β reverse primer Il 1β Reverse Primer, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il-1β reverse primer/product/Biolegio bv Average 90 stars, based on 1 article reviews
il-1β reverse primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
beta 2-microglobulin (β2m) Beta 2 Microglobulin (β2m), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/beta 2-microglobulin (β2m)/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
beta 2-microglobulin (β2m) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
t-bet forward primer 5′-caagggggcgtccaacaat-3′ T Bet Forward Primer 5′ Caagggggcgtccaacaat 3′, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t-bet forward primer 5′-caagggggcgtccaacaat-3′/product/Biolegio bv Average 90 stars, based on 1 article reviews
t-bet forward primer 5′-caagggggcgtccaacaat-3′ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
gata-3 reverse primer 5′-ggtggtctgacagttcgcac-3′ Gata 3 Reverse Primer 5′ Ggtggtctgacagttcgcac 3′, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gata-3 reverse primer 5′-ggtggtctgacagttcgcac-3′/product/Biolegio bv Average 90 stars, based on 1 article reviews
gata-3 reverse primer 5′-ggtggtctgacagttcgcac-3′ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
rorγt reverse primer 5′-tgcaggagtaggccacattaca -3′ Rorγt Reverse Primer 5′ Tgcaggagtaggccacattaca 3′, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rorγt reverse primer 5′-tgcaggagtaggccacattaca -3′/product/Biolegio bv Average 90 stars, based on 1 article reviews
rorγt reverse primer 5′-tgcaggagtaggccacattaca -3′ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
t-bet reverse primer 5′-tctggctctccgtcgttca-3′ T Bet Reverse Primer 5′ Tctggctctccgtcgttca 3′, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t-bet reverse primer 5′-tctggctctccgtcgttca-3′/product/Biolegio bv Average 90 stars, based on 1 article reviews
t-bet reverse primer 5′-tctggctctccgtcgttca-3′ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Addgene inc
psbbi-bla plasmid  Psbbi Bla Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/psbbi-bla plasmid/product/Addgene inc Average 90 stars, based on 1 article reviews
psbbi-bla plasmid - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Nature immunology
Article Title: The receptor DNGR-1 signals for phagosomal rupture to promote cross-presentation of dead cell-associated antigens
doi: 10.1038/s41590-020-00824-x
Figure Lengend Snippet: Addgene plasmids
Article Snippet: The receptors were sub-cloned with the Takara In-Fusion Cloning system into the pSBbi-GH vector (Addgene) using the following primers: Primer Name Primer Sequence C7 forward CCCCAAGCTTGGCCTTTACAGTTCCTTCTCACAGA C7 reverse ACCCCAAGCTGGCCTATGAAATATCACTCTCATATAGA C9::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATATACC C9(Y7F)::C7 reverse ACCCCAAGCTGGCCTATGCATGCGGAAGAAATATTTACC Open in a separate window The murine β-2 microglobulin sequence in the pGEM-T Easy plasmid was obtained from Addgene (deposited by Peter Mombaerts) and sub-cloned with the Takara InFusion Cloning system into the
Techniques: